1. Given the DNA sequence5’GTCGTACGATGCCATTACGAGGTGAGGCTGTTAGCTGATGGTGTTAT3’3’CAGCATGCTACGGTAATGCTCCACTCCGACAATCGACTACCACAATA5’What would the mRNA sequence be?5′ CAG-CAU-The amino acid sequence?If the indicated base pair (C:G) is changed to a (T:A) due to a mutation, what would happen to the amino acid sequence?What type of mutation is this?Do you think the protein would be functional? Why or why not?2. What would happen in each of the following situations:-If a researcher moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene. -If a researcher moves the operator to the far end of the operon, past the transacetylase (lacA) gene-If a researcher moves the repressor gene (lacI), along with its promoter, to a position several thousand base pairs away from its normal position.
Consider the following information, and answer the question below. China and England are international trade…
The CPA is involved in many aspects of accounting and business. Let's discuss some other…
For your initial post, share your earliest memory of a laser. Compare and contrast your…
2. The Ajax Co. just decided to save $1,500 a month for the next five…
How to make an insertion sort to sort an array of c strings using the…
Assume the following Keynesian income-expenditure two-sector model: AD = Cp + Ip Cp = Co…