Biology Assignment

Each 3 letter-word is equivalent to the codons in real mRNA.
What would the imaginary mRNA sequence look like if there was a single base substitution near the 5’ end of the mRNA? Write out the example above with the base substitution and 3- letter “codons” to explain your answer. Label the ends of your imaginary RNA and clearly show the mutation. (1 mark)

What would the imaginary mRNA sequence look like if there was a deletion of two bases near the 5’ end of the mRNA? Write out the example above with the two-base deletion and 3- letter “codons” to explain your answer. Label the ends of your imaginary RNA and clearly show the mutation. (1 mark)

What would the imaginary mRNA sequence look like if there was a single base deletion near the 5’ end of the mRNA? Write out the example above with the single base deletion and 3-letter “codons” to explain your answer. Label the ends of your imaginary RNA and clearly show the mutation. (1 mark)

2. A gene in flowers has the following DNA sequence (coding strand):
ACATTAACCATGGGAGTCGCAACTAGATGTTAA

The protein that is produced from this gene has the following sequence:
Met-Gly-Val-Ala-Thr-Arg-Cys

This protein is responsible for white-colored flower petals. Once in a while, sunlight will produce a single nucleotide mutation. This mutation changes the protein so that it gives flowers a yellow color. If the mutated protein is:
Met-Gly-Val-Ala-Thr-Arg-Arg
What is a possible DNA sequence for the mutated gene? (1 mark)

b) What would happen if the following insertion (underlined) in the original sequence occurred? (1 mark)
ACATTCGAACCATGGGAGTCGCAACTAGATGTTAA

3) Three major types of RNAs are mRNA, rRNA, and tRNA. For each of the conditions below predict the consequences in terms of the population of proteins being synthesized in a particular cell. What qualitative and quantitative changes, if any, are expected in the individual protein involved (if one is involved) and in the population of proteins produced in that cell? (4 marks)

(a) A frameshift mutation in mRNA. The condition is heterozygous in the involved cell. (2
marks)

(b) A mutation (homozygous) such that the result is the tRNA with anti-codon AUA no longer carries the amino acid tyrosine and instead carries serine. (2 marks)

4) What type(s) of mutation could lead to a change in one amino acid of a protein, but not result in an altered phenotype? Explain. (2 marks)

5) How would you explain to a friend the reason why dentists and physicians cover patients with lead aprons when they take mouth or other X-rays? (1 mark)
6) The gels on the following page show the results of manual dideoxy sequencing of a region of the cystic fibrosis (CF) gene. The gel on the right shows the results from a patient with CF, while the gel on the left shows the results from a normal patient. How does the amino acid sequence in the CF patient differ from that encoded by the DNA in the normal patient? Assume the strand used for the sequencing reactions is the coding strand for the CF gene. Show all your sequences and label the ends. Hint: Assume the region that has been sequenced is downstream of the start codon and you can start the translation with the first 3 nucleotides = Reading Frame 1. (6 marks)